Your Perfect Assignment is Just a Click Away

Starting at $8.00 per Page

100% Original, Plagiarism Free, Customized to Your instructions!

glass
pen
clip
papers
heaphones

For the gene annotation assignment, you will be assigned unknown DNA sequence that you will have to identify and annotate by completing the following task.

For the gene annotation assignment, you will be assigned unknown DNA sequence that you will have to identify and annotate by completing the following task.

 

For the gene annotation assignment, you will be assigned unknown DNA sequence that you will have to identify and annotate by completing the following task.

Must include screenshots at each step

  • Identify the open reading frame (ORF). Must describe the frame strand, positive or negative, frame 1, 2 or 3, what it means,
  • List the top three hits providing statistics such as, e-value, identity score, length etc. use the top hit to describe how the query aligns with the subject including the definitions as necessary. Use screenshot to explain.
  • Coding Sequence (CDS) Coding regions. State the coordinates of the start and stop codon. Or state if the gene is protein coding or not
  • Genomic location: State the chromosome on which the gene is found and location
  • List of exons
  • What is the gene name, organism, and gene id encoded by this DNA sequence? You can use any of the genomic browsers already covered. Explain why you concluded the sequence belong to the gene you have named.

Do not cut and paste your database results to report your findings. Write two to three paragraphs reporting the information you have obtained about this gene. Imagine this is a report you will present to an employer or a group of researchers interested in this gene.

here is the sequence:

 

ATGGACGGCCCCGGGGCCAGCGCCGTGGTCGTGCGCGTCGGCATCCCGGACCTGCAGCAGACGAAGTGCC
TGCGCCTGGACCCGACCGCGCCCGTGTGGGCCGCCAAGCAGCGCGTGCTCTGCGCCCTCAACCACAGCCT
CCAGGACGCGCTCAACTATGGGCTTTTCCAGCCGCCCTCCCGGGGCCGCGCCGGCAAGTTCCTGGACGAG
GAGCGGCTCCTGCAGGACTACCCGCCTAATCTGGACACGCCCCTGCCCTACCTGGAGTTTCGATACAAGC
GGCGAGTTTATGCCCAGAACCTCATCGATGATAAGCAGTTTGCAAAGCTTCACACAAAGGCGAACCTGAA
GAAGTTCATGGACTATGTCCAGCTGCATAGCACAGACAAGGTGGCCCGCCTGCTGGACAAGGGGCTGGAC
CCCAACTTCCATGACCCTGACTCAGGAGAGTGCCCCCTGAGCCTTGCAGCCCAGCTGGACAATGCCACGG
ACCTGCTGAAGGTGCTGAAGAACGGCGGTGCCCACCTGGACTTTCGCACTCGTGATGGGCTCACTGCTGT
GCACTGTGCCACACGCCAGCGGAATGCAGCGGCATTGACGACCCTGCTGGACCTGGGGGCATCACCTGAC
TACAAGGACAGCCGCGGCTTGACACCCCTCTACCACAGCGCCCTGGGGGGTGGGGATGCCCTCTGCTGTG
AGCTGCTTCTCCACGACCATGCTCAGCTGGGGACCACCGACGAGAATGGCTGGCAGGAGATCCACCAGGC
CTGCCGCTTCGGGCACGTGCAGCACCTGGAGCACCTGCTCTTCTACGGGGCAGACATGGGGGCCCAGAAC
GCCTCAGGGAACACAGCCCTGCACATCTGTGCCCTCTACAACCAGGAGAGCTGTGCTCGTGTCCTGCTCT
TCCGTGGAGCCAACAGGGATGTGCGTAACTACAACAGCCAGACAGCCTTCCAGGTGGCCATCATCGCAGG
GAACTTTGAGCTTGCAGAGGTTATCAAGACCCACAAAGACTCGGATGTTGTACCATTCAGGGAAACTCCC
AGCTATGCGAAGCGGCGGCGACTGGCTGGCCCCAGTGGCTTGGCATCCCCTCGGCCTCTGCAGCGCTCAG
CCAGCGATATCAACCTGAAGGGGGAGGCGCAGCCGGCAGCTTCTCCTGGACCCTCGCTGAGAAGCCTCCC
CCACCAGCTGCTGCTCCAGCGGCTGCAGGAGGAGAAAGATCGTGACCGGGATGCCGACCAGGAGAGCAAC
ATCAGTGGCCCCTTAGTAGGCAGGGGCAGCCAGAGCAAGATCAGCCCGAGCGGGCCTGGCGGCCCTGGCC
CTGCGCCCGGCCCCGGCCCCGCGCCCCCCGCGCCCCCCGCGCCGCCGCCCCGGGGCCCGAAGCGGAAACT
TTACAGCGCAGTCCCCGGCCGCAAGTTCATCGCTGTGAAGGCGCACAGCCCGCAGGGCGAAGGCGAGATC
CCGCTGCACCGCGGAGAGGCCGTGAAGGTGCTCAGCATTGGGGAGGGCGGTTTCTGGGAGGGAACCGTGA
AAGGCCGCACGGGCTGGTTCCCGGCTGACTGCGTGGAGGAGGTGCAGATGAGGCAGCATGACACGAGGCC
TGAAACCCGTGAGGACCGGACAAAGCGGCTTTTTCGGCACTACACTGTGGGCTCCTACGACAGCCTCACC
TCACACAGCGATTATGTCATTGATGACAAAGTGGCCGTCCTGCAGAAACGGGACCACGAGGGCTTTGGTT
TTGTGCTCCGGGGAGCCAAAGCAGAGACCCCCATCGAGGAGTTCACGCCCACACCAGCCTTCCCAGCGCT
GCAGTATCTTGAGTCGGTGGACGTGGAGGGTGTGGCCTGGAAGGCCGGGCTTCGCACAGGAGACTTCCTC
ATTGAGGTGAATGGGGTGAACGTGGTGAAGGTTGGACACAAGCAGGTGGTAGCTCTGATCCGCCAGGGTG
GCAACCGCCTTGTCATGAAGGTTGTGTCTGTGACAAGAAAGCCGGAAGAGGATGGGGCTCGGCGCAGAGC
CCCACCGCCCCCCAAGAGGGCCCCCAGCACCACACTGACCCTGCGCTCCAAGTCCATGACAGCTGAGCTC
GAGGAACTTGCCTCCATTCGGAGAAGAAAAGGGGAGAAGCTGGACGAGATGCTGGCAGCCGCCACAGAGC
CGACGCTGAGGCCAGACATCGCAGACGCGGACTCCAGAGCCGCCACAGTCAAACAGCGGCCCACCAGTCG
GAGGATCACACCTGCTGAGATTAGTTCATTGTTTGAACGCCAGGGCCTCCCAGGCCCAGAGAAGCTGCCG
GGCTCCTTGCGGAAGGGGATTCCACGGACCAAATCTGTAGGGGAGGACGAGAAGCTGGCGTCCCTGCTGG
AAGGGCGCTTCCCGCGGAGCACGTCGATGCAAGACCCGGTGCTGCGCGAGAGTCGCGGCATCCCGCCCCC
GCCGCAGACCGCGCCGCCGCCCCCGCCCGCGCCCTACTACTTCGACTCGGGGCCGCCCCCGGCCTTCTCG
CCGCCGCCCCCGCCGGGCCGCGCCTACGACACGGTGCGCTCCAGCTTCAAGCCCGGCCTGGAGGCGCGCC
TGGGCGCGGGGGCTGCCGGCCTGTACGATCCCGGCGCGGCCCTCGGCCCGCTGCCCTACCCCGAGCGGCA
GAAGCGCGCGCGCTCCATGATCATCCTGCAGGACTCGGCGCCGGAGACGAGCGACGTCCCCCGGCCCCCG
CCCGCAGGCACCCCGCCCGAGCGCCCCAAGCGCCGGCCGCGGCCGCCCGGCCCCGACAGCCCCTATGCCA
ACCTGGGCGCCTTCAGCGCCAGCCTCTTCGCGCCGTCCAAGCCGCAGCGCCGCAAGAGCCCGCTGGTGAA
GCAGCTGCAGGTGGAGGATGCGCAGGAGCGCGCGGCCCTGGCCGTGGGCAGCCCCGGGCCCGGCGGCGGC
AGCTTCGCACGCGAGCCCTCCCCGACCCACCGTGGTCCCCGACCCGGCGGCCTCGACTACGGCGCGGGCG
ACGGCCCGGGGCTCGCGTTCGGCGGCCCGGGCCCGGCCAAGGACCGGCGGCTGGAGGAGCGGCGCCGCTC
CACTGTGTTCCTGTCCGTGGGCGCCATCGAGGGCAGCGCCCCCAGCGCGGACCTGCCATCCCTGCAGCCC
TCCCGCTCCATCGACGAGCGCCTCTTGGGCACCGGCCCCACCGCCGGCCGCGACTTGCTGCTGCCCTCCC
CGGTGTCTGCTCTGAAGCCATTGGTCAGCGGCCCGACCCTCGGGCCCTCAGGCTCCACCTTCATCCACCC
GCTCACCGGCAAACCCCTGGACCCCAGCTCACCCCTGGCCCTTGCCCTGGCTGCCCGAGAGCGGGCTCTG
GCCTCCCAGGCACCCTCCCGGTCCCCCACGCCCGTGCACAGCCCCGACGCCGACCGCCCTGGACCCCTGT
TTGTGGATGTGCAGGCCCGGGACCCAGAGCGAGGGTCCCTGGCGTCGCCAGCCTTCTCCCCGCGAAGCCC
GGCCTGGATTCCTGTGCCTGCTCGCAGGGAGGCAGAGAAGGCCCCCCGGGAGGAGCGGAAGTCACCTGAG
GACAAGAAGTCCATGATCCTCAGCGTTCTGGACACATCCCTGCAGCGGCCAGCCGGCCTCATCGTTGTGC
ATGCCACCAGCAACGGGCAGGAGCCCAGCAGGCTGGGGGCCGAAGAGGAGCGCCCGGGCACCCCGGAGTT
GGCCCCGGCCCCCATGCAGTCAGCGGCTGTGGCTGAGCCCCTGCCCAGCCCCCGGGCCCAGCCCCCTGGC
AGCACCCCGGCAGAACCTGGGCCAGGTCAGGGCAGCTCAGAGGAAGAGCCAGAGCTGGTGTTTGCTGTGA
ACCTACCACCCGCTCAGCTGTCGTCTAGCGATGAGGAGACCAGGGAGGAGCTGGCCCGGATTGGGCTGGT
GCCACCCCCAGAAGAGTTTGCCAACGGGGTCCTGCTGGCCACCCCACTCGCTGGCCCGGGCCCCTCGCCC
ACCACGGTGCCCAGCCCGGCCTCAGGGAAGCCCAGCAGTGAGCCACCCCCTGCCCCTGAGTCTGCAGCCG
ACTCCGGGGTGGAGGAGGCTGACACACGCAGCTCCAGCGACCCCCACCTGGAGACCACAAGCACCATCTC
CACGGTGTCCAGCATGTCCACCTTGAGCTCAGAGAGCGGGGAACTCACTGACACCCACACCTCCTTCGCT
GACGGACACACTTTTCTACTCGAGAAGCCACCAGTGCCTCCCAAGCCCAAGCTCAAGTCCCCGCTGGGGA
AGGGGCCGGTGACCTTCAGGGACCCGCTGCTGAAACAGTCCTCGGACAGCGAGCTTATGGCCCAGCAGCA
CCATGCCGCCTCTGCCGGGCTGGCCTCTGCCGCCGGGCCTGCCCGCCCTCGCTACCTCTTCCAGAGAAGG
TCCAAGCTATGGGGGGACCCCGTGGAGAGCCGGGGGCTCCCTGGGCCTGAAGACGACAAACCAACTGTGA
TCAGTGAACTCAGCTCCCGCCTGCAGCAGCTGAACAAAGACACGCGTTCCCTGGGGGAGGAACCAGTTGG
TGGCCTGGGCGGCCTGCTGGACCCTGTCAAGAAGTCGCCCATCGCAGCAGCTCGGCTCTTCAGCAGCCTC
GGTGAGCTGAGCTCCATTTCAGCGCAGCGCAGCCCCGGGGGCCCGGGCGGCGGGGCCTCCTACTCGGTGA
GGCCCAGCGGCCGCTACCCCGTGGCGCGACGCGCCCCGAGCCCTGTGAAGCCCGCGTCGCTGGAGCGGGT
GGAGGGGCTGGGGGCGGGCGCGGGGGGAGCAGGGCGGCCCTTCGGCCTCACGCCCCCCACCATCCTCAAG
TCGTCCAGCCTCTCCATCCCGCACGAGCCCAAGGAGGTGCGCTTCGTGGTGCGCAGCGTGAGCGCACGCA
GCCGCTCCCCCTCGCCATCGCCGCTGCCCTCGCCCGCGTCCGGCCCCGGCCCCGGCGCCCCCGGCCCGCG
CCGGCCCTTCCAGCAGAAGCCGCTGCAGCTCTGGAGCAAGTTCGACGTGGGCGACTGGCTGGAGAGCATC
CACCTGGGCGAGCACCGTGACCGCTTCGAGGACCATGAGATCGAAGGCGCGCACCTCCCCGCGCTCACCA
AGGACGACTTCGTGGAGCTGGGCGTCACGCGCGTGGGCCACCGCATGAACATCGAGCGCGCGCTCAGGCA
GCTGGACGGCAGCTGA

"Place your order now for a similar assignment and have exceptional work written by our team of experts, guaranteeing you A results."

Order Solution Now

Our Service Charter


1. Professional & Expert Writers: Ace Tutors only hires the best. Our writers are specially selected and recruited, after which they undergo further training to perfect their skills for specialization purposes. Moreover, our writers are holders of masters and Ph.D. degrees. They have impressive academic records, besides being native English speakers.

2. Top Quality Papers: Our customers are always guaranteed of papers that exceed their expectations. All our writers have +5 years of experience. This implies that all papers are written by individuals who are experts in their fields. In addition, the quality team reviews all the papers before sending them to the customers.

3. Plagiarism-Free Papers: All papers provided by Ace Tutors are written from scratch. Appropriate referencing and citation of key information are followed. Plagiarism checkers are used by the Quality assurance team and our editors just to double-check that there are no instances of plagiarism.

4. Timely Delivery: Time wasted is equivalent to a failed dedication and commitment. Ace Tutors is known for the timely delivery of any pending customer orders. Customers are well informed of the progress of their papers to ensure they keep track of what the writer is providing before the final draft is sent for grading.

5. Affordable Prices: Our prices are fairly structured to fit in all groups. Any customer willing to place their assignments with us can do so at very affordable prices. In addition, our customers enjoy regular discounts and bonuses.

6. 24/7 Customer Support: At Ace Tutors, we have put in place a team of experts who answer all customer inquiries promptly. The best part is the ever-availability of the team. Customers can make inquiries anytime.